Polymorphisms-in-the-Apolipoprotein B-100 Gene: Association With Plasma Lipid Concentration and Coronary Artery Disease
Ratna Dua Puri, Satyendra Tewari, Nakul Sinha, V Ramesh, Faisal
Khan,
Vivek P Singh, Suraksha Agrawal
Departments of Medical Genetics, Cardiology and Pathology,
Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow
Background: The aim of this study was to investigate the association of apolipoprotein B gene polymorphisms with coronary artery disease and lipid levels in Indians.
Methods and Results: One hundred patients of angiographically proven atherosclerotic coronary artery disease and one hundred age- and sex-matched control subjects (treadmill negative) were included in the study. Serum lipids including cholesterol, triglycerides, high-density lipoprotein, low-density lipoprotein, very low-density lipoprotein, and apolipoprotein B were analyzed. Genomic DNA was extracted and the apolipoprotein B 3' hypervariable region amplified by polymerase chain reaction. Regions carrying Xba1, EcoR1, and Msp1 restriction sites present in the apolipoprotein B gene were amplified and digested separately by the respective enzymes. Restriction fragment length polymorphism analysis showed that EcoR1 with the R+/R+ genotype was significantly more common in patients with coronary artery disease. Overall, the genotypes EcoR1+/+, Msp1+/+, Xba1+/+ and Eco R1+/+ Msp1+/–, Xba1–/– were significantly more common in patients as compared to controls (p<0.05). When gene polymorphisms were compared with lipid abnormalities, the genotypes EcoR1+/+, Xba1–/–, and Msp1+/+ were more frequent in patients with elevated apolipoprotein B and very low-density lipoprotein levels. On the other hand, these genotypes were less common in patients with increased total cholesterol and low-density lipoprotein levels. When we studied the individual alleles of the variable number of tandem repeats region, we observed that allele 34 was significantly increased in patients with coronary artery disease as compared to controls. Allele 36 was present with a frequency of 1% in controls while it was totally absent in patients.
Conclusions: This study identifies the apolipoprotein B gene polymorphism associated with coronary artery disease. An association between apolipoprotein B gene polymorphisms and elevated apolipoprotein B and very low-density lipoprotein levels was observed. However, there was no positive association with other elevated lipid levels in North Indians from Uttar Pradesh.
(Indian Heart J 2003; 55: 60–64)Key Words: Apolipoprotein B, Polymorphism, Coronary artery disease
E
levated serum low-density lipoprotein (LDL) concentration is an important risk factor for developing atherosclerotic coronary artery disease (CAD) in humans.1 Apolipoprotein (apo) B-100 is the principal protein component of LDL. The interaction of apo B-100 with LDL receptors mediates the uptake of LDL from the liver and peripheral cells; hence, apo B-100 plays an important role in cholesterol homeostasis.2 The apo B gene is localized on chromosome 2, and the complete structure of the human apo B-100 gene has been elucidated.3Cloning and sequencing of the apo B gene has made it possible to study the variation in the apo B gene at the DNA level. A 15 bp AT-rich hypervariable region (HVR) is located adjacent to the 3' end of the apo B gene. It consists of a variable number of tandem repeat sequences (VNTR). Previous studies have reported that some of the "3' VNTR" alleles4–6 and restriction fragment length polymorphisms (RFLP)4,7,8 of apo B-100 are directly associated with CAD, or with variations in plasma lipids. Interestingly, the association of apo B-100 VNTR and RFLPs with plasma lipid concentration or CAD varies in different ethnic groups9 and has not always been found to be associated with CAD or hyperlipidemia.10,11
The incidence of CAD is increasing in India, especially in the younger population. Hence, it is important to delineate risk factors for CAD in Indians. There are very few studies from India which report the effect of apo B polymorphisms on CAD or lipid levels. The present study is an attempt to analyze the allele frequency of apo B-100 3' VNTR and apo B-100 RFLPs in the Indian population and to determine their association with plasma lipid concentration and CAD.
Methods
Subjects: One hundred patients of angiographically proven CAD evaluated at the Cardiology Department of the Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow, Uttar Pradesh, India were included in the study. Patients less than 6 weeks post-myocardial infarction (MI) were excluded from the study. One hundred age- and sexmatched controls were also selected for the study. The controls were subjected to a treadmill test to ensure that they were not suffering from any CAD. Further, all controls with hypertension, diabetes, and endocrine or metabolic disorders were excluded. Informed consent was taken from both the patients and controls.
Lipid analysis: Blood samples were taken after a fasting period of 12 hours from all the patients and controls. Serum lipids including cholesterol, triglycerides, high-density lipoprotein (HDL), LDL, and very low-density lipoprotein (VLDL) were analyzed according to methods previously described.12,13 Apolipoprotein B levels were assessed by the immunoturbidimetric immunoassay using a commercial kit (Randox Laboratories Ltd, UK).
DNA preparation: Genomic DNA was extracted by the high salting-out procedure followed by phenol chloroform extraction and ethanol precipitation.14
Analysis of VNTR: Apolipoprotein B 3' HVR amplification was carried out by PCR using a forward and reverse oligonucleotide primer encompassing the entire apo B 3' VNTR sequence. The sequence of the primer used was 5' ATGCAAACGGAGAAATTATG 3' and 5' CCTTCTCACTTGCCAAATAC 3'. The polymerase chain reaction (PCR) was performed in an M.J. Research Inc. Thermocycler, with 26 cycles of denaturation at 94oC for 1 min, and annealing and extension at 58oC for 6 min. The amplified product was electrophoresced in 5% polyacrylamide gel, and allele sizing was done using the apo B 3' VNTR allelic ladder and a commercial ladder 50 bp in size (Fig. 1).

Analysis of RFLP: Regions of the apo B gene carrying EcoR1, Msp1, and Xba1 restriction sites were amplified separately using their respective primers: 5' CTG, GCT, TGC, TAA CCT, CTC, TG and 3' GAG, AAG, CTT, CCT, GAA, GCT, CG for EcoR1, 5' TCT, CGG, GAA, TAT, TCA, GGA, ACT, ATT, G and 3' CTA, AGG, ATC, CTG, CAA, TGT, CAA, GGT for Msp1 and 5' GGA,GAC, TAT, TCA, GAA, GCT, AA and 3' GAA, GAG, CCT, GAA, GAC, TGA, CT for Xba1. The amplified product was separately digested with the respective enzymes as previously described.15 Alleles of each polymorphic site were classified as (+) or (–) according to the presence or absence at the cutting site of each restriction enzyme, respectively.
Statistical analysis: Allele and genotypic frequency analysis for apo B 3' VNTR and RFLP was done using the POPGENE-16 version. The Student’s t test was used for comparisons using the SPSS software.
Results
One hundred patients with angiographically proven CAD (90 males, 10 females) and 100 normal controls (90 males and 10 females) were evaluated. The mean age of the patients was 50.74±9.7 years, while that of the controls was 50.41±12.23 years.
Lipid levels: The mean lipid levels of patients with CAD and controls were not significantly different. However, lipid levels were higher in patients as compared to controls.
Allele frequency and genotyping for EcoR1, Xba1, and Msp1: The comparison of the genotypic and allele frequencies of the EcoR1, Xba1, and Msp1 RFLPs of the apo B gene in patients with CAD and controls is shown in Table 1. The only significant RFLP pattern was with EcoR1, with the R+/R+ genotype expressed more frequently in patients with CAD (p=0.001), while the R+/R– genotype was more common in controls (p=0.001). The genotypes E+ E+ M+ M+ X+ X+ and E+ E+ M+ M– X– X– were significantly more prevalent in patients with CAD (p<0.05). The genotype E+ E– M+ M– X– X–, on the other hand, was more common in controls (p<0.05).


VNTR analysis: Relative frequencies of VNTR in patients with CAD and controls are shown in Fig. 2. The VNTR allele 34 was significantly increased in patients with CAD as compared to that in controls, while allele 36 was significantly increased in controls. Interestingly, VNTR allele 36 was totally absent in patients.
Correlation of VNTR, RFLP, and lipid parameters with the age of the patients with CAD: When young patients with CAD (age <45 years, n=46) were analyzed, there was no significant increase in any allelic and genotypic frequencies of different apo B polymorphisms as compared to older patients (age >45 years, n=54). However, when patients with CAD were compared to controls, the older patients with CAD had a higher frequency of EcoR1 (+) allele, while the EcoR1 (–) allele was less common in both the age subgroups.
Correlation of RFLP and HVR allele with lipid parameters: In patients with CAD, the genotypes R+/R+, X–/X– and M+/M+ were frequent in those with elevated apo B and VLDL levels. On the other hand, these genotypes were less frequent in patients with increased total cholesterol and LDL levels. The allele Msp1 (–) was significantly less common in patients with elevated LDL levels.
Among controls, the trend of association was the same as in the patient group but the results were not significant in the controls, even in those with elevated apo B and VLDL levels.
Discussion
On the basis of evidence obtained over many years from epidemiological and trial data, LDL- and HDL-cholesterol levels have been the recommended lipid variables in international guidelines for treatment. However, new information shows the importance of apo B and apo A-I as risk predictors for CAD.16 A reason why apo B may be a stronger predictor of risk than LDL-cholesterol is that apo B is present not only in LDL but also in VLDL, intermediate density lipoprotein, and lipoprotein (a). Therefore, the sum of apo B concentrations in all atherogenic particles might be a better risk marker than total cholesterol and LDLcholesterol levels only.16 In our study, the entire lipid levels, including those of apo B, were higher in patients as compared to controls; however, these did not reach statistical significance. One possible explanation for this could be that lipid-lowering drugs were not withheld prior to lipid testing for this study as this would not have been ethically justifiable in patients who had angiographically proven CAD with dyslipidemia and were already on lipidlowering drugs.
It has been suggested that in addition to quantitative variation in apo B levels in the plasma, genetic variation at the apo B locus may be a new and independent risk factor for CAD.17
It has been reported that different VNTR alleles may be associated with CAD and hyperlipidemia.4–6 We found an association of VNTR 34 in patients with CAD similar to that reported by Moreel et al.4 The allelic variation of apo B gene polymorphisms may have some association with various ethnic groups. Deka et al.9 in a study of allelic frequency distribution at the hypervariable locus 3' to the apo B gene in 5 human populations found 12 segregating alleles in 319 individuals. They found that the two most frequent alleles, 37 and 39, were present in all the populations. When we studied VNTR we found that allele 34 was significantly increased in patients as compared to controls, while allele 36 was completely absent in patients but present in controls. This clearly demonstrates the presence of allelic frequency variation in different populations. These association studies may be of some use when genetic factors are considered as one of the predisposing causes.
There are few studies on Indians that show the association of the apo B gene 3' HVR alleles with CAD and plasma lipid levels. Renges et al.18 found an association between Xba1 and ins/del polymorphisms of the apo B gene with total cholesterol and HDL-cholesterol levels in South Asians in the UK. Saha et al.19 reported that DNA polymorphisms of the apo B gene were associated with obesity and serum lipids in healthy Indians in Singapore. Misra et al.,20 on the other hand, have reported that apo B (Xba1 and EcoR1) polymorphisms did not appear to influence serum lipid levels. In our study, we found that the genotypes R+/R+, X–/X– and M+/M+ were frequent in patients with elevated apo B and VLDL levels. However, these genotypes were decreased in patients with elevated cholesterol and LDL levels.
Pan et al.6 found that apo B 3' VNTR genotypic variation had little impact on the risk of dyslipidemia in a Taiwanese population but despite this, the long apo B 3' VNTR alleles occurred more frequently in patients with CAD. Hegele et al.17 also found a significant correlation between apo B gene polymorphisms and CAD, without any significant association with either LDL or VLDL. Similar results were reported in a porcine model of atherosclerosis in which an apo B genetic variant was associated with atherosclerosis, despite normal lipid levels.21 Our results show that the apo B gene variations possibly do not affect the apo B–LDLreceptor binding region, and thus do not affect the lipid levels. Other studies have also shown similar trends.17 We speculated that a mutation in the protein coding region of apo B could affect the interaction of LDL with monocyte macrophages, endothelial cells, ground substance, clotting factors, or the immune system in a manner that would promote atherogenesis.22
The clinical relevance of apo B polymorphisms still remains unclear. All studies in the past reflect the genetic heterogeneity of the apo B gene. As CAD is a multifactorial disease, the apo B gene alone may not have a direct effect on the lipid profile or severity and prematurity of CAD. However, it does emphasize the importance of such studies, which may help in future to delineate the high-risk group for CAD, and may be of use in the genetic screening of patients with CAD belonging to different populations.
Correspondence:
Professor Suraksha Agrawal,
Department of Medical
Genetics, Sanjay Gandhi Postgraduate Institute of Medical Sciences,
Raebareli Road, Lucknow 226014.
e-mail : suraksha@sgpgi.ac.in
References
Kannel WB, Castelli WP, Gordon T. Cholesterol in the prediction of atherosclerotic disease. New perspectives based on the Framingham Study. Ann Intern Med. 1979; 90: 85–91
Brown MS, Goldstein JL. How LDL receptors influence cholesterol and atherosclerosis. Sci Am 1984; 251: 58–66
Knott TJ, Rall SC Jr, Innerarity TL, Jacobson SF, Urdea MS, Levy-Wilson B, et al. Human apolipoprotein B: structure of carboxyl-terminal domains, sites of gene expression, and chromosomal localization. Science 1985; 230: 37–43
Moreel JF, Roizes G, Evans AE, Arveiler D, Cambou JP, Souriau C, et al. The polymorphism ApoB/4311 in patients with myocardial infarction and controls: the ECTIM Study. Hum Genet 1992; 89: 169–175
Cavalli SA, Hirata MH, Salazar LA, Diament J, Forti N, Giannini SD, et al. Apolipoprotein B gene polymorphisms: prevalence and impact on serum lipid concentrations in hypercholesterolemic individuals from Brazil. Clin Chim Acta 2000; 302: 189–203
Pan JP, Chiang AN, Chou CY, Chan WL, Tai JJ. Polymorphisms of the apolipoprotein B 3' variable number of tandem repeats region associated with coronary artery disease in Taiwanese.
de Padua Mansur A, Annicchino-Bizzacchi J, Favarato D, Avakian SD, Machado Cesar LA, Franchini Ramires JA. Angiotensin-converting enzyme and apolipoprotein B polymorphisms in coronary artery disease. Am J Cardiol 2000; 85: 1089–1093
Machado MO, Hirata MH, Bertolami MC, Hirata RD. Apo B gene haplotype is associated with lipid profile of higher risk for coronary heart disease in Caucasian Brazilian men. J Clin Lab Anal 2001; 15: 19–24
Deka R, Chakraborty R, DeCroo S, Rothhammer F, Barton SA, Ferrell RE. Characteristics of polymorphism at a VNTR locus 3' to the apolipoprotein B gene in five human populations. Am J Hum Genet 1992; 51: 1325–1333
Helio T, Palotie A, Totterman KJ, Ott J, Kauppinen-Makelin R, Tikkanen MJ. Lack of association between the apolipoprotein B gene 3' hypervariable region alleles and coronary artery disease in Finnish patients with angiographically documented coronary artery disease. J Intern Med 1992; 231: 49–57
Turner PR, Talmud PJ, Visvikis S, Ehnholm C, Tiret L. DNA polymorphisms of the apoprotein B gene are associated with altered plasma lipoprotein concentration but not with perceived risk of cardiovascular disease. European Atherosclerosis Research Study. Atherosclerosis 1995; 116: 221–234
Allain CC, Poon LS, Chan CS, Richmond W, Fu PC. Enzymatic determination of total serum cholesterol. Clin Chem 1974; 20: 470– 475
Fossati P, Prencipe L. Serum triglycerides determined colorometrically with an enzyme that produces hydrogen peroxide. Clin Chem 1982; 28: 2077–2080
Olerup O, Zetterquist H. HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: an alternative to serological DR typing in clinical practice including donor–recipient matching in cadaveric transplantation. Tissue Antigens 1992; 39: 225–235
Pan JP, Chiang AN, Tai JJ, Wang SP, Chang MS. Restriction fragment length polymorphisms of apolipoprotein B gene in Chinese population with coronary heart disease. Clin Chem 1995; 41: 424–429
Walldius G, Jungner I, Holme I, Aastveit AH, Kolar W, Steiner E. High apolipoprotein B, low apolipoprotein A-I, and improvement in the prediction of fatal myocardial infarction (AMORIS study): a prospective study. Lancet 2001; 358: 2026–2033
Hegele RA, Huang LS, Herbert PN, Blum CB, Buring JE, Hennekens CH, et al. Apolipoprotein B-gene DNA polymorphisms associated with myocardial infarction. N Engl J Med 1986; 315: 1509–1515
Renges HH, Wile DB, McKeigue PM, Marmot MG, Humphries SE. Apolipoprotein B gene polymorphisms are associated with lipid levels in men of South Asian descent. Atherosclerosis 1991; 91: 267–275
Saha N, Tay JS, Heng CK, Humphries SE. DNA polymorphisms of the apolipoprotein B gene are associated with obesity and serum lipids in healthy Indians in Singapore. Clin Genet 1993; 44: 113–120
Misra A, Nishanth S, Pasha ST, Pandey RM, Sethi P, Rawat DS. Relationship of Xba1 and EcoR1 polymorphisms of apolipoprotein-B gene to dyslipidemia and obesity in Asian Indians in North India. Indian Heart J 2001; 53: 177–183
Rapacz J, Hasler-Rapacz J. Investigations on the relationship between immunogenetic polymorphisms of betalipoproteins and the betalipoprotein and cholesterol in swine. In: Lenzi S, Descovich GC (eds). Atherosclerosis and cardiovascular disease. Bologna: Editrice Compositori; 1984. pp. 99–108
Ross R. The pathogenesis of atherosclerosis—an update. N Engl J Med 1986; 314: 488–500